Course Contents:

Introduction, History and scope of animal Biotechnology

Laboratory requirements

Growth media composition & preparation

Cell & tissue culture procedures

Evaluation and maintenance of cell lines

Cloning of cell lines

Tissue and organ cultures

Tissue engineering

In Vitro fertilization and embryo transfer

Animal cloning

Transfection methods and transgenic animals

Embryonic stem cell transfer

Gene replacement

BASIC OVERVIEW ON ANIMAL BIOTECHNOLOGY

Animal biotechnology is a branch of biotechnology in which biotechnological tools and techniques treats the animal cells, tissues, or other parts that  are used to develop(transgenics) or to improve animal in order to get specific products for pharmaceutical or industrial and agricultural applications.

Sectors of Applications of Animal Biotechnology

Stem cells and cancer research

Drug and vaccine development

Transgenic animal development 

Cells, tissues or organs transplantation

Biopharming 

Therapeutics, diagnostics & Molecular medicine 

3D- Bioprinting technology 

 

 

 

 

Hybridoma technology

Antibody engineering

Gene therapy & Genetic counseling

Simpal Kumar Suman- Founder-Director at Biotechticle Research Group | Biotechnologist | Mathematical Biologist | Molecular Biologist | Bio-modeller | Molecular Data Analyst | Python-C++R- Programmer | Scientific Writer | Bio-IT

CGTCAGAGGCACGTCAACATCTTAAAGATGGCACTTG
CTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGAT
GCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC
GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCT

CGTCAGAGGCACGTCAACATCTTAAAGATGGCACTTG
CTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGAT
GCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC
GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCT