Course Contents:

Introduction & Basic technologies

Concepts of immunology in human

Human diseases

Genetic basis of diseases

Immune Pathogenesis

Microbial Pathogenesis

Modulating Gene Expression

Cell and tissue engineering

Molecular diagnostics

Protein Therapeutics

Nucleic acid therapeutic agents and human gene therapy

Vaccines development

BASIC OVERVIEW ON MEDICAL  BIOTECHNOLOGY

Medical biotechnology is defined as the application of biotechnological tools and techniques in which the use of living cells, tissue, organs, or bodies to research and produce diagnostic and pharmaceutical products that can be used for the diagnosis, prevention, and treatment of diseases.

21st  century is the fast-growing time of medical biotechnology. Many national and international companies, research institutes, government bodies are taking an interest in research and development in medical biotechnology.

Medical biotechnology plays critical roles during emerging of new chronic diseases either microbial or non-microbial. One of the best examples of Ebola disease and its causing agent is the Ebola virus. The first drug of Ebola disease is ZmappTm  which is developed by Mapp pharmaceuticals corporation and Bioleaf corporation. Both are international biotech companies.

Medical biotechnology is related to our health, development of new drugs, work against bacterial, fungal, viral, cancer diseases, and so on.

Simpal Kumar Suman- Founder-Director at Biotechticle Research Group | Biotechnologist | Mathematical Biologist | Molecular Biologist | Bio-modeller | Molecular Data Analyst | Python-C++R- Programmer | Scientific Writer | Bio-IT

CGTCAGAGGCACGTCAACATCTTAAAGATGGCACTTG
CTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGAT
GCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC
GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCT

CGTCAGAGGCACGTCAACATCTTAAAGATGGCACTTG
CTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGAT
GCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC
GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCT