



Course Contents:
Introduction to Bioinformatics
Applications of Bioinformatics
Omics Technologies in Bioinformatics
Classification of Biological Database
Biological Sequence Analysis
Sequence Alignments
Dynamic Programming
Biological Sequence Formats
Molecular Phylogenetics
Molecular interactions
Molecular Pathway modeling
Predictions tools and softwares
Artificial Intelligence in Bioinformatics
BASIC OVERVIEW ON BIOINFORMATICS
Literally, the word Bioinformatics consists of two words: Biology and information. We can say, bioinformatics is the science of biological information. It is an interdisciplinary field of applied Biological science and has become key to modern Biotechnology. Bioinformatics provides the solution of complex biological datasets into a simpler form for researchers. This branch has become a wide and integral part of computational molecular Biology. In this branch, the computer plays a significant role, and software (tools) helps in synchronization and arrangement of raw Biological data (or in random data) into significant forms. There are various forms of biological data to be used in basic to applied manners depends on researchers what they want to do. The retrieval of biological data from the living system is the major determinant of research objectives. But the major raw biological data are nucleic acid sequences such as DNA and RNA  and amino acid sequences in proteins and peptides. Bioinformatics software packages (tools) play important roles in the modern breeding program during synchronization of genotype to phenotype ( reverse genetics). Synchronization of different biological datasets and their predictions at the molecular level is the significant strategies in modern biotechnology. Bioinformatics has broad spectrum applications in various fields of life sciences and great deals with agriculture, medicine and healthcare and biodiversity conservation along with human welfare. In medical science, to diagnosis and treatment of diseases, bioinformatics playing significant roles. It helps in drug discovery, gene therapy, prediction of drug action, mathematical modeling of metabolic processes, signalling and regulatory pathways determination. Due to the bioinformatics, an advanced branch has emerged which is Systems Biology. Systems Biology solely based on bioinformatics. Bioinformatics tool helps in sketching and drawing of cells, metabolic pathways, regulatory mechanism pathways, structures of bio-molecules and modelling diagram at the molecular level. The applications of bioinformatics are limitless. In modern time, bioinformatics is the pillar of biotechnology and it is an extension of applications of computer science in biological sciences.
Simpal Kumar Suman- Founder-Director at Biotechticle Research Group | Biotechnologist | Mathematical Biologist | Molecular Biologist | Bio-modeller | Molecular Data Analyst | Python-C++R- Programmer | Scientific Writer | Bio-IT
CGTCAGAGGCACGTCAACATCTTAAAGATGGCACTTG
CTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGAT
GCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC
GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCT
CGTCAGAGGCACGTCAACATCTTAAAGATGGCACTTG
CTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGAT
GCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC
GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCT